Thursday, June 4, 2015

Objective: Run PCR products from 06/01/2015 on a gel to verify Luciferase and GFP primers were correct, and if primers were correct and bands are shown remove bands and send out for sequencing

Ran out PCR products from 06/01/2015 on gel
Lanes as seen in the picture,
1 Ladder (Hyper Ladder 1)
2 GFP 1 (P1)
3 GFP 2 (P2)
4 Control
5 Control
6 Blank
7 Blank
8 Luciferase 1 (R1)
9 Luciferase 2 (R2)
10 Control
11 Control
12 ladder (Hypper ladder 1)

sr_IDPrimer namePrimer Sequencedate ordered#bpGC%OrganismGeneGene Accession#location on referencepair w/sr_IDproduct sizeIDT #
1604 Rr_46_65FCGGATGATAACTGGTCCGCA8/20/142055 Renilla reniformisLuciferaseM6350146-651603822124903282
1603 Rr_887_868RTCAGGTGCATCTTCTTGCGA8/20/142050 Renilla reniformisLuciferaseM63501887-8681604822124903283
1602 Pg_1_PP6_53_72FCGGCAAAAGCTAGCGTTGAA8/18/142050  Ptilosarcus gurneyiPtilosarcus Green Fluorescent Protein (GFP)HV097611  53-7216011054124817505
1601 Pg_2_PP9_1107_1088RACGTGCGGTCTCTTTATGCT8/18/142050 Ptilosarcus gurneyiPtilosarcus Green Fluorescent Protein (GFP)HV097611  1107-108816021054124817506

Results: Lane 2 and 3 showed multiple bands none within anticipated length of 1054 but still removed brightest band in lane 3 in line with size "800" on the ladder. Lane 8 and 9 showed bright bands that were in line with the correct size of 822 removed both bands. All removed bands were sent purified and sent out for sequencing by Sam

No comments:

Post a Comment