06/04/2015
Objective: Run PCR products from 06/01/2015 on a gel to verify Luciferase and GFP primers were correct, and if primers were correct and bands are shown remove bands and send out for sequencing

Ran out PCR products from 06/01/2015 on gel
Lanes as seen in the picture,
1 Ladder (Hyper Ladder 1)
2 GFP 1 (P1)
3 GFP 2 (P2)
4 Control
5 Control
6 Blank
7 Blank

8 Luciferase 1 (R1)

9 Luciferase 2 (R2)
10 Control
11 Control

12 ladder (Hypper ladder 1)

sr_ID	Primer name	Primer Sequence	date ordered	#bp	GC%	Organism	Gene	Gene Accession#	location on reference	pair w/sr_ID	product size	IDT #
1604	Rr_46_65F	CGGATGATAACTGGTCCGCA	8/20/14	20	55	Renilla reniformis	Luciferase	M63501	46-65	1603	822	124903282
1603	Rr_887_868R	TCAGGTGCATCTTCTTGCGA	8/20/14	20	50	Renilla reniformis	Luciferase	M63501	887-868	1604	822	124903283
1602	Pg_1_PP6_53_72F	CGGCAAAAGCTAGCGTTGAA	8/18/14	20	50	Ptilosarcus gurneyi	Ptilosarcus Green Fluorescent Protein (GFP)	HV097611	53-72	1601	1054	124817505
1601	Pg_2_PP9_1107_1088R	ACGTGCGGTCTCTTTATGCT	8/18/14	20	50	Ptilosarcus gurneyi	Ptilosarcus Green Fluorescent Protein (GFP)	HV097611	1107-1088	1602	1054	124817506

Results: Lane 2 and 3 showed multiple bands none within anticipated length of 1054 but still removed brightest band in lane 3 in line with size "800" on the ladder. Lane 8 and 9 showed bright bands that were in line with the correct size of 822 removed both bands. All removed bands were sent purified and sent out for sequencing by Sam