Objective: A final update on the research
Results: With the success of the qPCR I was able to complete my paper. The qPCR showed amplification of my sequence validating that my sequence is viable for P. gurneyi molecular work, the daytime samples show low amplification during the day and out of the 4 nighttime samples 2 of them showed much higher amplification in comparison to the daytime samples. Due to the small sample size nothing definitive can be concluded about my sequences amplification at night further research is necessary and verification that the sequence is indeed related to Luciferase. Further reaserch may be able to support the hypothesis that amplification of the Luciferase enzyme is higher at night than during the day. This concludes my research for now on the orange sea pen (Ptilosarcus gurneyi). a link to the paper is below covering the behavioral study and Luciferase production.
Paper
https://docs.google.com/document/d/1cmJKgJZ55wJTxqHJyjghMW-6cflsoIo8eL9vNCIkAy8/edit?usp=sharing
Tuesday, December 1, 2015
Wednesday, November 18, 2015
qPCR
Objective: Take cDNA and perform a qPCR to quantify gene expression for 3 sets of samples amplified using 2 different primers
Primers
qPCR Protocol
PCR PLATE
Day 1-4 are samples taken during manipulation experiment where animals were under artifical lighting to simulate day time hours.
Night 1-4 animals left in the dark for two hours to simulate a night time environment.
Results
qPCR calculations
Primer set 1
Quantitation
Link to data:
https://docs.google.com/spreadsheets/d/1XJRXXuiJhDiIlJ-Br6-g-lJjVEifGOmaOubv4rrRj6M/edit?usp=sharing
Melting Curve
Primer Set 2
Quantitiation
Melting Curve
Note: realized that I had forgotten my no template controls when doing the experiment will rerun qPCR to confirm that data is valid.
Primers
qPCR Protocol
Standard Operating Protocol (SOP)
Written 20150702 by Sam White.
Reagents:
- SsoFast EvaGreen Supermix (BioRad: 172-5203)
- Primer working stocks (10uM)
- DNase-free H2O (NanoPure H2O)
Personal Protective Equipment (PPE):
- Gloves
Equipment:
- Pipettes (10 - 1000uL)
- Filtered pipette tips
- White PCR plates, non-skirted, low profile (USA Scientific: 1402-9590)
- Optically clear strip caps (USA Scientific: 1400-3800)
- Sterile 1.7mL snap-cap microfuge tubes (Genesee: 22-281S)
- Real-time PCR machine
- ice
Procedure
Total Time: ~ 2.0 - 4.0hrs
Cost/sample: ~ $0.42
- Read the manufacturer's protocol.
- Read this protocol.
- Verify sufficient quantities of reagents and samples before beginning.
- Wear clean gloves.
- Prepare master mix. Be sure to make a master mix volume that will accommodate the following: all of your samples, two water (i.e. no template controls; NTC) samples, plus an extra 10% to accommodate pipetting errors. A single reaction is shown below:
Component Volume(uL) Final Concentration 2x SsoFast EvaGreen Supermix 10 1x Forward Primer (10uM) 0.5uL 0.2uM Reverse Primer (10uM) 0.5uL 0.2uM Water Variable Use to bring reaction volume up to 20uL (including template) - Distribute appropriate amount of master mix (volume of master mix + template = 20uL) to white PCR plate.
- Add template.
- Cap with optical PCR caps.
- Spin plate for 1min @ 3000g.
- Put plate in real-time PCR machine.
- Recommended cycling parameters (40 cycles) are listed below. They may need to be changed to accommodate your specific primers/samples. See manufacturer's protocol for recommendations.Step 1 - 98C 2minsStep 2 - 98C 5secsStep 3 - 60C 5secsStep 4 - Plate readStep 5 - Got to Step 2 39 more timesStep 6 - Melt curve 65C - 95C, increment 0.5C, wait 2secs, plate read.
Calculations:
PCR PLATE
Sample Definitions:
1-1, 1-2, 2-1, 2-2 Samples taken originally for sequencing work added them to compare to samples taken at a later date to check for variation due to time in captivity,Day 1-4 are samples taken during manipulation experiment where animals were under artifical lighting to simulate day time hours.
Night 1-4 animals left in the dark for two hours to simulate a night time environment.
Results
qPCR calculations
Primer set 1
Quantitation
Link to data:
https://docs.google.com/spreadsheets/d/1XJRXXuiJhDiIlJ-Br6-g-lJjVEifGOmaOubv4rrRj6M/edit?usp=sharing
Melting Curve
Quantitiation
Note: realized that I had forgotten my no template controls when doing the experiment will rerun qPCR to confirm that data is valid.
Friday, October 30, 2015
Objective: Take the tissue samples I collected from the sea pens earlier for sequencing (using as a check to compare to other samples to see if the sea pens may have given different data earlier since the longer they were in captivity the more stress they were under) and the daytime and nighttime tissue samples and extract RNA from them Using Roberts Lab RNA isolation protocol, then create CDNA using the Roberts lab Reverse Transcription protocol .(https://github.com/sr320/LabDocs/wiki/Common-Lab-Protocols)
RNA extraction
CDNA Calculations
Results
Sucessfully extracted RNA from the tissue samples and checked the RNA concentrations of all samples using the NANO drop (ND-1000) shown below, all RNA extractions were successful.
(note: I thought it was interesting that all of the day time samples had a higher concentration than the night time samples though I can not draw any conclusions from it an interesting find)
CDNA was sucessfull the next step will be to run a QPCR to check expression levels.
RNA Concentrations ng/ul
1-1=916.4
1-2=423.0
2-1=934.9
2-2=737.0
Day-1=322.9
Day-2=412.4
Day-3=403.1
Day-4=729.1
Night-1=152.2
Night-2=314.2
Night-3=276.7
Night-4=202.4
RNA extraction
- Read the SOPs for each of the reagents used in this protocol.
- Read the manufacturer's RNAzol RT protocol for Total RNA Isolation.
- Read this protocol.
- Verify sufficient quantities/availability of reagents/equipment.
- Wear clean gloves and change gloves frequently.
- Aliquot 500uL of RNAzol RT to pestle tubes and store on ice.
- Transfer tissue to pestle tubes containing RNAzol RT.
- Homogenize immediately with disposable pestle.
- Immediately add additional 500uL of RNAzol RT to pestle tube.
- Vortex 15s.
- Add 400uL of 0.1% DEPC-treated H2O.
- Vortex 15s.
- Incubate at room temperature (RT) for 15mins.
- Centrifuge 12,000g for 15mins @ RT.
- Transfer 750uL of supernatant (do not disturb pellet) to sterile 1.7mL snap-cap tube. (Discard remaining liquid in RNAzol RT Hazardous Waste container in fume hood. Leave old tube open in fume hood over night and then discard in regular trash.)
- Add 1 volume of isopropanol.
- Vortex 5s.
- Incubate @ RT for 15mins.
- Centrifuge 12,000g for 10mins @ RT.
- Discard supernatant; do not disturb pellet.
- Add 400uL of 75% ethanol, centrifuge 4,000g for 3mins @ RT.
- Repeat steps 20 and 21 one time.
- Repeat step 20.
- Centrifuge 4,000g for 1min @ RT.
- Removal residual ethanol.
- Immediately resuspend pellet in appropriate volume of 0.1% DEPC-H2O (volume is dependent upon pellet size, but 50uL is usually sufficient).
- Keep sample on ice for short-term storage (i.e. no more than 2hrs) or store @ -80C.
Reverse Transcription
Standard Operating Protocol (SOP)
Written 20150702 by Sam White.
Reagents:
- M-MLV Reverse Transcriptase (Promega: M1701)
- Primers (oligo dT: Promega: C1101 OR random: Promega: C1181)
- 10mM dNTPs (Promega: U1511)
Personal Protective Equipment (PPE):
- Gloves
Equipment:
- Pipettes (10 - 1000uL)
- Filtered pipette tips
- 0.5mL snap-cap microfuge tubes (Genesee: 22-178A)
- Sterile 1.7mL snap-cap microfuge tubes (Genesee: 22-281S)
- Thermal cycler, water bath, or heating block capable of 37C OR 42C.
- vortexer
- ice
Procedure
Total Time: ~ 1.5 - 2.0hrs
Cost/sample: ~ $1.50
IMPORTANT: A single reaction volume = 25uL. The volume of RNA, primer(s) and M-MLV RT used in this protocol are variable and will be specific to your current experiment. The directions below apply to a reaction using 1ug of total RNA. You may need to make changes to accommodate your own conditions.
- Read the manufacturer's protocol.
- Read this protocol.
- Verify sufficient quantities of reagents and samples before beginning.
- Wear clean gloves.
- Thaw all RNA and reagents on ice. Prepare all reactions on ice.
- Transfer 1ug of RNA to 0.5mL snap cap tubes or PCR plate. Adjust volumes of individual samples to 17.75uL with H2O.
- Add 0.25ug primer per 1ug of RNA in sample (= 0.5uL of Promega oligo dT Cat#C1101 in this example). Total volume (RNA + primers) should equal 18.25uL.
- Heat samples at 70C for 5 min in thermal cycler, heating block, or water bath.
- Place samples on ice IMMEDIATELY.
- Make Master Mix:Per Reaction
- 5 uL 5x Buffer (M-MLV RT Buffer)
- 1.25 uL 10mM dNTPs
- 0.5 uL M-MLV RT per ug of RNA
- Mix well by flicking; do not vortex.
- Add 6.75uL of master mix to each reaction.
- Mix by pipetting; do not vortex.
- Incubate @ 42C for 1hr for oligo dT primers OR @ 37C for random primers.
- Heat inactivate @ 95C for 3 min.
- Spot spin and store @-20C.
Results
Sucessfully extracted RNA from the tissue samples and checked the RNA concentrations of all samples using the NANO drop (ND-1000) shown below, all RNA extractions were successful.
(note: I thought it was interesting that all of the day time samples had a higher concentration than the night time samples though I can not draw any conclusions from it an interesting find)
CDNA was sucessfull the next step will be to run a QPCR to check expression levels.
RNA Concentrations ng/ul
1-1=916.4
1-2=423.0
2-1=934.9
2-2=737.0
Day-1=322.9
Day-2=412.4
Day-3=403.1
Day-4=729.1
Night-1=152.2
Night-2=314.2
Night-3=276.7
Night-4=202.4
Friday, October 2, 2015
Primers for luciferase gene expression experiment.
Objective: To design primers from the consensus sequence derived from multiple sequences produced from P. gurneyi samples.
Results:
I used 8 (pictured below) aligned in geneious to create the primers. I choose these primers because they all seemed to align with each other without any outlier sequences. To create the primers I used NCBI primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and under organism changed the default Homo Sapien to Cnidaria and restricted the size from 100 to 400 . So that I could cover multiple parts of the Consensus Primer_pgurneyi_1 and Primer_pgurneyi_2 Cover opposite ends of the consensus. Primer 1 Forward covers from base 25-44 and reverse from 200-181. Primer 2 forward base 329-348 and reverse from 467 to 448. All NCBI results are pictured below. Will begin RNA extraction on 8 samples (Day 1-4, and Night 1-4) starting next week. I was thinking of adding in the 4 samples that were used for sequencing since they were taken when the Sea Pens were "newer and in better shape but I will ask Dr. Roberts if that is worth the effort. I will be extracting RNA hopefully next week from 8 samples collected earlier that have been stored in the -80 freezer.
Primers
Concensus sequence
TTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC
Results:
I used 8 (pictured below) aligned in geneious to create the primers. I choose these primers because they all seemed to align with each other without any outlier sequences. To create the primers I used NCBI primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and under organism changed the default Homo Sapien to Cnidaria and restricted the size from 100 to 400 . So that I could cover multiple parts of the Consensus Primer_pgurneyi_1 and Primer_pgurneyi_2 Cover opposite ends of the consensus. Primer 1 Forward covers from base 25-44 and reverse from 200-181. Primer 2 forward base 329-348 and reverse from 467 to 448. All NCBI results are pictured below. Will begin RNA extraction on 8 samples (Day 1-4, and Night 1-4) starting next week. I was thinking of adding in the 4 samples that were used for sequencing since they were taken when the Sea Pens were "newer and in better shape but I will ask Dr. Roberts if that is worth the effort. I will be extracting RNA hopefully next week from 8 samples collected earlier that have been stored in the -80 freezer.
Primers
| sr_ID | Primer name | Primer Sequence | Designed By | date ordered | #bp | GC% | melting temp | Organism | Gene |
| 1710 | Primer_pgurneyi_2_fwd | CGACATTATCCGCCGTTTCG | JDA | 10/8/2015 | 20 | 55 | 59.77 | P. Gurneyi | Luciferase RNA |
| 1709 | Primer_pgurneyi_2_rev | CCGCTCGGATGATAACTGGT | JDA | 10/8/2015 | 20 | 55 | 59.77 | P. Gurneyi | Luciferase RNA |
| 1708 | Primer_pgurneyi_1_fwd | TATACATGGCATCGTCGGGC | JDA | 10/8/2015 | 20 | 55 | 60.04 | P. Gurneyi | Luciferase RNA |
| 1707 | Primer_pgurneyi_1_rev | TTTCCAAAGCTCATTGCCGC | JDA | 10/8/2015 | 20 | 50 | 60.04 | P. Gurneyi | Luciferase RNA |
Concensus sequence
TTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC
![]() |
| Sequences used for Consensus sequence |
![]() |
| Sequences used for Consensus sequence |
![]() |
| Primers options I used 1 and 8 |
| Primers results #1 (Primer_pgurneyi_1_fwd/rev) |
| Primers results #8 (Primer_pgurneyi_2_fwd/rev) |
Friday, August 28, 2015
Objective: Continue working with the sequencing data to help decide how to move forward with the project.
Results: Found that the highest likely candidate for the sequences may have been a bacteria Rhodopseudomonas palustris so contacted Dr. Carrie Harwood in the harwood labs at UW medical center to learn more information about that bacteria and see if it was a possible candidate and to see if she had some available DNA that I may be able to work with. I was considering to PCR the DNA with my primers to see if they showed any expression and possible the same I was seeing in my own PCRs. She replied back saying that it was not marine bacteria so it's not likely what I have been sequencing. She also said she should have some DNA on file that I could work with but Dr. Roberts felt that it was not necessary since the species was not marine. Dr. Roberts has me convert all of my sequences into a Fasta file which was uploaded to eagle. (http://eagle.fish.washington.edu/scaphapoda/index.php?dir=Jonathan%2F)
Results: Found that the highest likely candidate for the sequences may have been a bacteria Rhodopseudomonas palustris so contacted Dr. Carrie Harwood in the harwood labs at UW medical center to learn more information about that bacteria and see if it was a possible candidate and to see if she had some available DNA that I may be able to work with. I was considering to PCR the DNA with my primers to see if they showed any expression and possible the same I was seeing in my own PCRs. She replied back saying that it was not marine bacteria so it's not likely what I have been sequencing. She also said she should have some DNA on file that I could work with but Dr. Roberts felt that it was not necessary since the species was not marine. Dr. Roberts has me convert all of my sequences into a Fasta file which was uploaded to eagle. (http://eagle.fish.washington.edu/scaphapoda/index.php?dir=Jonathan%2F)
Wednesday, August 12, 2015
Sequencing work and NCBI blasting of new sequences and outliers
1. Take the new data and work with NCBI to try to find out what was sequenced using BlastN and BlastX.
2. Align the new sequences produced on august 10th to the Renilla reniformis sequence used to create primers.
3. Check NCBI blast of sequence outliers that did not align with the majority of sequences using BlastN and BlastX.
4. Check NCBI to see if Renilla sequence matches any other luciferase sequences using BlastN and BlastX.
Results:
1. The concencous sequence did show a relationship to Renilla reniformis though it had a low e-value
2. The alignment of the new sequences to Renilla reniformis only aligned when the cost matrix of the Geneious alignment was at 51%, and when I did a muscle alignment, though it showed a lot of gaps which questions the validity of the alignment. At 51% gaps were visible but were small usually only 1 base pair long.
3. Outliers did not show a strong e-value so unlikely that it would be useable
4. The Renilla sequence used to produce the primers did relate to other Luciferase sequences but with a very low e-value.
Side note: Blogger is not allowing me to add in titles between pictures. Not sure how to work with it so I can better differentiate each area. The conflict seems to be how to images are formatted in blogger
![]() |
| NCBI BLASTN SUITE: Consensus sequence produced august 10th 2015 |
![]() |
| BLASTX: Consensus sequence produced august 10th 2015 |
![]() |
| Geneious alignment of sequences produced august 10th 2015 compared to Renilla reniformis sequence used to produce primers , Cost Matrix 51% |
![]() |
| Geneious alignment of sequences produced august 10th 2015 compared to Renilla reniformis sequence used to produce primers, Cost matrix 65% |
![]() |
| Geneious alignment of sequences produced august 10th 2015 compared to Renilla reniformis sequence used to produce primers, Cost matrix 70% |
![]() |
| Geneious alignment of sequences produced august 10th 2015 compared to Renilla reniformis sequence used to produce primers, Cost Matrix 93% |
![]() |
| Muscle alignment of sequences produced august 10th 2015 compared to Renilla reniformis sequence used to produce primers |
alignment of all sequencing data (note: running blasts on oddball sequences that did not align with majority shown to the left)
|
![]() |
| Sequences blasted |
![]() |
| BlastN of PenF-01-luciferase_f.ab1 |
![]() |
| BlastX of PenF-01-luciferase_f.ab1 |
![]() |
| BlastN of PenF-02-luciferase_f.ab1 |
![]() |
| BlastX of PenF-02-luciferase_f.ab1 |
![]() |
| BlastN PenR-01-Luciferase_R.ab1 |
![]() |
| BlastX PenR-01-Luciferase_R.ab1 |
![]() |
| BlastN PenR-02-Luciferase_R.ab1 |
![]() |
| BlastX PenR-02-Luciferase_R.ab1 |
![]() |
| BlastN SeaPen_luciferase_R1-Rr_46_65F.1.ab1 |
![]() |
| BlastX SeaPen_luciferase_R1-Rr_46_65F.1.ab1 |
![]() |
| BlastN SeaPen_luciferase_R1-Rr_46_65F.ab1 |
![]() |
| BlastX SeaPen_luciferase_R1-Rr_46_65F.ab1 |
![]() |
| BlastN of Renilla Luciferase cDNA |
![]() |
| BlastX of Renilla Luciferase cDNA |
Subscribe to:
Posts (Atom)











































