Objective: To design primers from the consensus sequence derived from multiple sequences produced from P. gurneyi samples.
Results:
I used 8 (pictured below) aligned in geneious to create the primers. I choose these primers because they all seemed to align with each other without any outlier sequences. To create the primers I used NCBI primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and under organism changed the default Homo Sapien to Cnidaria and restricted the size from 100 to 400 . So that I could cover multiple parts of the Consensus
Primer_pgurneyi_1 and Primer_pgurneyi_2 Cover opposite ends of the consensus. Primer 1 Forward covers from base 25-44 and reverse from 200-181. Primer 2 forward base 329-348 and reverse from 467 to 448. All NCBI results are pictured below. Will begin RNA extraction on 8 samples (Day 1-4, and Night 1-4) starting next week. I was thinking of adding in the 4 samples that were used for sequencing since they were taken when the Sea Pens were "newer and in better shape but I will ask Dr. Roberts if that is worth the effort. I will be extracting RNA hopefully next week from 8 samples collected earlier that have been stored in the -80 freezer.
Primers
sr_ID | Primer name | Primer Sequence | Designed By | date ordered | #bp | GC% | melting temp | Organism | Gene |
1710 | Primer_pgurneyi_2_fwd | CGACATTATCCGCCGTTTCG | JDA | 10/8/2015 | 20 | 55 | 59.77 | P. Gurneyi | Luciferase RNA |
1709 | Primer_pgurneyi_2_rev | CCGCTCGGATGATAACTGGT | JDA | 10/8/2015 | 20 | 55 | 59.77 | P. Gurneyi | Luciferase RNA |
1708 | Primer_pgurneyi_1_fwd | TATACATGGCATCGTCGGGC | JDA | 10/8/2015 | 20 | 55 | 60.04 | P. Gurneyi | Luciferase RNA |
1707 | Primer_pgurneyi_1_rev | TTTCCAAAGCTCATTGCCGC | JDA | 10/8/2015 | 20 | 50 | 60.04 | P. Gurneyi | Luciferase RNA |
Concensus sequence
TTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC
 |
Sequences used for Consensus sequence |
 |
Sequences used for Consensus sequence |
 |
Primers options I used 1 and 8 |
 |
Primers results #1 (Primer_pgurneyi_1_fwd/rev) |
 |
Primers results #8 (Primer_pgurneyi_2_fwd/rev) |
Luciferase is an enzyme that catalyzes production of light from luciferin in the presence of Mg2+-ATP and oxygen. The reaction of this enzyme with luciferin, ATP, luciferase
ReplyDelete