Primers for luciferase gene expression experiment.

Objective: To design primers from the consensus sequence derived from multiple sequences produced from P. gurneyi samples.

Results:
I used 8 (pictured below) aligned in geneious to create the primers. I choose these primers because they all seemed to align with each other without any outlier sequences. To create the primers I used NCBI primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and under organism changed the default Homo Sapien to Cnidaria and restricted the size from 100 to 400 . So that I could cover multiple parts of the Consensus Primer_pgurneyi_1 and Primer_pgurneyi_2 Cover opposite ends of the consensus. Primer 1 Forward covers from base 25-44 and reverse from 200-181. Primer 2 forward base 329-348 and reverse from 467 to 448. All NCBI results are pictured below. Will begin RNA extraction on 8 samples (Day 1-4, and Night 1-4) starting next week. I was thinking of adding in the 4 samples that were used for sequencing since they were taken when the Sea Pens were "newer and in better shape but I will ask Dr. Roberts if that is worth the effort. I will be extracting RNA hopefully next week from 8 samples collected earlier that have been stored in the -80 freezer. 



Primers

sr_ID	Primer name	Primer Sequence	Designed By	date ordered	#bp	GC%	melting temp	Organism	Gene
1710	Primer_pgurneyi_2_fwd	CGACATTATCCGCCGTTTCG	JDA	10/8/2015	20	55	59.77	P. Gurneyi	Luciferase RNA
1709	Primer_pgurneyi_2_rev	CCGCTCGGATGATAACTGGT	JDA	10/8/2015	20	55	59.77	P. Gurneyi	Luciferase RNA
1708	Primer_pgurneyi_1_fwd	TATACATGGCATCGTCGGGC	JDA	10/8/2015	20	55	60.04	P. Gurneyi	Luciferase RNA
1707	Primer_pgurneyi_1_rev	TTTCCAAAGCTCATTGCCGC	JDA	10/8/2015	20	50	60.04	P. Gurneyi	Luciferase RNA

Concensus sequence
TTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC

Sequences used for Consensus sequence

Sequences used for Consensus sequence

Primers options I used 1 and 8

Primers results #1 (Primer_pgurneyi_1_fwd/rev)

Primers results #8 (Primer_pgurneyi_2_fwd/rev)