Friday, October 2, 2015

Primers for luciferase gene expression experiment.

Objective: To design primers from the consensus sequence derived from multiple sequences produced from P. gurneyi samples.

Results:
I used 8 (pictured below) aligned in geneious to create the primers. I choose these primers because they all seemed to align with each other without any outlier sequences. To create the primers I used NCBI primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and under organism changed the default Homo Sapien to Cnidaria and restricted the size from 100 to 400 . So that I could cover multiple parts of the Consensus Primer_pgurneyi_1 and Primer_pgurneyi_2 Cover opposite ends of the consensus. Primer 1 Forward covers from base 25-44 and reverse from 200-181. Primer 2 forward base 329-348 and reverse from 467 to 448. All NCBI results are pictured below. Will begin RNA extraction on 8 samples (Day 1-4, and Night 1-4) starting next week. I was thinking of adding in the 4 samples that were used for sequencing since they were taken when the Sea Pens were "newer and in better shape but I will ask Dr. Roberts if that is worth the effort. I will be extracting RNA hopefully next week from 8 samples collected earlier that have been stored in the -80 freezer. 



Primers
sr_IDPrimer namePrimer SequenceDesigned Bydate ordered#bpGC%melting tempOrganismGene
1710Primer_pgurneyi_2_fwdCGACATTATCCGCCGTTTCGJDA10/8/2015205559.77P. GurneyiLuciferase RNA
1709Primer_pgurneyi_2_revCCGCTCGGATGATAACTGGTJDA10/8/2015205559.77P. GurneyiLuciferase RNA
1708Primer_pgurneyi_1_fwdTATACATGGCATCGTCGGGCJDA10/8/2015205560.04P. GurneyiLuciferase RNA
1707Primer_pgurneyi_1_revTTTCCAAAGCTCATTGCCGCJDA10/8/2015205060.04P. GurneyiLuciferase RNA

Concensus sequence
TTCAGGTGCATCTTCTTGCGAGAATATACATGGCATCGTCGGGCTCTGCCTCGCGTATCGATATGATTTGGTTGCCTACCCGCTTTTCCGGGTTTATTAATAAAGTTGAAATCTTACCATGTTTCCGGTCGGACCATCATTATGTGTTTATTGAGATGCATTTACCTTTTTCTGTTGTTCGCGGCAATGAGCTTTGGAAACTCAATTTTTCATTATTAAAAGACGAATGTTTATGCCAGAAAATTATGGACTTCTGGAAGATATGGAAGGTCCAAAAACATGTTTACCTTCCCTCCGTTTGGTGGGAACTTGGAAAAAAGCGTCTTATCGACATTATCCGCCGTTTCGGTCGAAGCCGTGCTAGCGCAGTGCGCGATCGTGTTGCTGATTTAACTGCCCAATTGAATTGCATGCAAAAACAAGTTTTACAAGGTAATGCCACTGCGGACCAGTTATCATCCGAGCGGACC


Sequences used for Consensus sequence
Sequences used for Consensus sequence

Primers options I used 1 and 8

Primers results #1 (Primer_pgurneyi_1_fwd/rev)

Primers results #8 (Primer_pgurneyi_2_fwd/rev)

No comments:

Post a Comment