Tuesday, October 7, 2014

10/7/2014
Objective: Verify Sea Pen luciferase sequence was sucessfuly replicated using primerse based on  Renilla Reniformes luciferase sequence acquired on Genebank.

PCR gel run today
Sea pen 1 and 2
1-1 lane 2 (note: Made sea pen luminescence before taking samples on both 1-1 (base cut) and 1-2 (top cut) )
1-2 lane 3 (note: Made sea pen luminescence before taking samples on both 1-1 1-2)
2-1 lane 4
2-2 lane 5
- lane 6
- lane 7
Bioline hyper ladder 1








Joined Dr. Roberts class lab and performed a conventional pcr (2x Apex Red)
6 tube 1-1,1-2,2-1,2-2,and 2 negative control tubes
master mix
2x apex red 12.5ul*6 =75ul
f primer 0.5ul*6 3ul

r primer 0.5ul*6 3ul
h20 6.5ul*6 39ul
=20ul per tube
template 5ul*6 30ul

95c-10 min
40 cycles of
95c 15s
50c 15s
72c 1min

Results: Replication was successful removed the brightest bands in lane 3 and 4 from the gel, and purified to prepare for sequencing. Samples were sent to "" (will add later)
 Found out that the problem with the reverse transcription quantities was a pipetting error on the 10ul pipet i was using to much because of a mix up on the decimal place of the pipette

Introduced a spacer for the sea pens to keep them from touching each other testing it on the 5 gallon bucket . It splits the bucket in half reducing the area they are able to move around in without blocking flow or height the pen can extend Will see if it improves individual health of the sea pens.

With the automatic feeder I have noticed that the Pens have become much more consistent in activity so I believe I am set it up so that all of them can be sustained for a long period of time though more time will be needed to tell if this is true. It may be beneficial to create a paper just on my setup which could help others working with sea pens or related species.

Thursday, October 2, 2014

10/2

Objerctive: Convert RNA to cDNA using

Methods:

Reverse Transcription (Promega M-MLV: Cat#M1701; ) [Cost per sample ~$1.50]


A single reaction volume = 25uL. The volume of RNA, primer(s) and M-MLV RT used are variable and will be specific to your current experiment. The directions below apply to a reaction using 1ug of total RNA. You may need to make changes to accommodate your own conditions.

  1. Use as much RNA as possible (up to 1ug); max volume of RNA = 17.75uL. Generally, identify the RNA sample with the lowest concentration and multiply by 17.75uL. Use this quantity (ug) of RNA for each and every sample.
  2. Transfer calculated volume(s) of RNA to 0.5mL snap cap tubes or PCR plate. Adjust volumes of individual samples to 17.75uL with H2O.
  3. Add appropriate amount of primer to sample. Use 0.25ug primer per 1ug of RNA in sample (= 0.5uL of Promega oligo dT Cat#C1101 in this example). Total volume (RNA + primers) should equal 18.25uL.
  4. Heat samples at 70C for 5 min in thermocycler.
  5. Place samples on ice IMMEDIATELY.
  6. Make Master Mix:

PER RXN
5 uL 5x Buffer (M-MLV RT Buffer)
1.25 uL 10mM dNTPs (Promega Cat#U1511)
0.5 uL M-MLV RT per ug of RNA

7. Mix well.
8. Add 6.75uL of master mix to each reaction.
9. Mix well, but do not vortex.
10.Spot spin.
11.Incubate @ 42C for 1hr in thermalcycler for oligo dT primers OR @ 37C for random primers.
12.Heat inactivate @ 95C for 3 min.
13.Spot spin.
14.Store @ -20C.

3/17/2011 SJW

Starting RNA 1ug calculations
1-1 .99ul
1-2 2.31ul
2-1 1.13 ul
2-2 1.50 ul

Results:  Procedure was going well until we reached the Master Mix solution. noticed that their was to much master mix left over so it is likely somewhere in the creation of the MM or pipetting the MM into the solution that an error was made. We still ran the entire protocol to see if anything was successful. Planning on running the PCR next week to verify that the primers that were ordered are valid.

Checked on the Sea pens today the changes to the peristaltic pump appeared to be successful everything was running correctly and the levels in the feeding bucket were the same as when I left yesterday. I am still considering removing the reverse flow on the pump into the bucket so the quantities of artemia being delivered are more consistent but will watch the sea pens to see if this makes a difference. I noticed that in each of the buckets with two sea pens that 1 sea pen is very inflated and looks healthy and the other does not so it is possible that they do not do well when in close quarters with each other possible because they are attacking each other when touching. I would like to take some tissue samples to verify that they in fact do have nematocysts though the I will have to look into if it would be visible just by looking through the microscope may need to find a way to fire them off which we had done in lab I will talk with Claire to see.

Wednesday, October 1, 2014

10/1

Peristaltic pump began leaking and flooding aquarium room today after some investigation I found the hose being used for the pump was breaking down. I replaced the hose but the next day it wound up in the rotar and destroyed the hose. After talking with Jon about possible solutions I made changes to the pump by adding more rotars to help hold everything in place and added wing nuts to secure everything. Regular rotation of the tubing will also help to reduce breakdown of the tubing (note: ask greg about ordering some peristaltic tubing to reduce issues.

Redesigned the feeding schedule to match tide fluctuations. Currently setup to feed for 3 hours at 6am which mirrors the sea pens normal feeding regiment better than 6 times a day for an hour. it is likely the pens were not getting enough access to the artemia.

I would like to look into the feeding habits of the sea pen and sea if I can get data to support the sea pens using luminescnece to attract artemia.

Saturday, September 27, 2014

Took samples from two of the sea pens removing pieces of fringes from the top and lower sections with scissors and a scalpol. Removed each of the pens from the water and placed on a tray. (notes: sea pens were very heavy and filled with water. once out of the water they started to leak the water reducing in size. With touch the pens started luminescing and started to shrivel making it difficult to take tissue from them. Best method was to quickly take tissue as soon as taken out of water so that the specimen did not have the chance to shrivel. One Pen was nicked on the inside of the stock and water rushed out. The Pens inflate themselves like a balloon increase greatly in volume in the water.) The sea pen recovered fully and it behavior in the tank stayed consistent with the others. it was able to inflate lower area below cut enabling it to grow not sure now it separates the area that was cut. Both pens seems to not be effected to harshly from the removal of tissue.

Sam went through everything for the RNA extraction going over step by step and teaching me the location and how to use all reagents and protocol. RNA extraction was a success numbers were successful


Made changes to the feeding schedule and setup.  added a paralytic pump with a line pushing artemia into the tank and another pulling water into the 5 gallon food storage bucket. feeding every 6 hours for 1 hour.

Helped Jake with counts at Taylor shellfish and with maintenance in Olympia cleaning trays doing counts and transferring them to new cages.

An interest in bioluminescence original idea that it is a way to attract a predator to what is eating it is unlikely since what eats sea pens is not preyed upon by many thing that use visual ques. Plus the idea that sea pens light scares off what ever is trying to eat it is not supported since nudibranches, and starfish due not rely heavily on vision. After talking with Jake, and Professor Jensen my thought is that since artemia and other zooplankton are attracted to light it would make sense that a sea pen would light up to attract its prey.

Ordered more artemia from greg which has yielded much more artemia with each batch the past eggs were very old and it was very hard to keep consistent with the amount of artemia.  When adding new artemia to the 5 gallon bucket 3 gallons are added and 1 gallon is added directly to the tank. The pump does not seem to be consistant with the amount of water it is moving back into the bucket so making some changes to equalize it may be nessecary though it is not enough yet to cause any issues. I had taken away the automatic feeder that was adding marine food flake to the aquarium and quickly noticed a decline in the sea pens. The note that they are detritivoreis supported I think they feed on both the artemia and the flake food that is made up of many diffrent types of marine ingredients.

Omega one Marine flakes:











Ingredients:
Whole Herring, Whole Salmon, Halibut, Black Cod, Seafood Mix (Krill, Rockfish, Shrimp, Squid, Clams, Salmon Eggs, and Octopus), Wheat Flour, Wheat Gluten, Fresh Kelp, Spirulina, Garlic, Lecithin, Astaxanthin, L-Ascorbyl-2-Phosphate (Source of Vitamin C), Natural and Artificial Colors, Vitamin A Acetate, Vitamin D3 Supplement, Vitamin E Supplement, Vitamin B12 Supplement, Riboflavin, Niacin, Pantothenic Acid, Folic Acid, Biotin, Inositol, Tocopherol (Preservative), Ethoxyquin (Preservative).
Guaranteed Analysis:
Crude protein (min) 43%, crude fat (min) 12%, crude fiber (max) 2%, moisture (max) 8.5%, ash (max) 8%, phosphorus (min) .5%, omega 3 (min) 2%, omega 6 (min) 1%.

9/25 First mortality occurred the upper portion (fringes) seemed to be disintegrating  and the upper structure became very stiff and hard though the lower section seemed to still be alive which may be since this a colonial organism if one part dies the other may still be able to survive though it is likely without the ability to gather food would perish very quickly. The process happened within 2 days change was fairly rapid. (Note: the sea pen was in close proximity to other sea pens I am wondering if it they may attack each other when to close. Speaking with Greg he noted that in the wild they are not found close to one another so when touching it is possible that they use some defense to attack the others possibly using feeding structures (autozooids) with nematocysts.






Friday, August 8, 2014

7/24-8/8




















Took two weeks to get an appointment with Dr. lewis but was able to and it was extremely helpful. She explained that I was looking at the biolumenescence reaction wrong or not fullly. I was looking to effect the main reaction but had the genetic information for luceferase. luceferase is likely produced consistently and stored. by manipulating the oxygen levels it would effect the initial reaction but would likely have no effect on the animals producing luceferase. So when it went to check if levels of luceferase had been manipulating it by changing the amount of oxygen it may effect the initial reaction and change the amount of light produced but since oxygen is not related to the production of luceferase when i checked genetic information it is likely their would be not change.
oxygen depletion and ocean acidification manipulation have many other effects on the animals and it would be hard to tell if that is actually the cause of the change in the luminescence or it is just causing extra stress and not directly effecting the animal. Dr. Al-noori brought up in class that and easy way to effect the reaction would be to effect the inter-cellular calcium storage where the calcium used to initiate the release of luceferase from storage would be. using a calcium kelator, or inter-cellular calcium channel blocker may be more efficient since it would not allow the release of the luceferase

One thing to look at may be to look into checking if luceferase is indeed constantly produced or if it is only produced when needed. it is likely since the animal uses this as a defensive function that it would make sure that the levels were never depleted by constantly producing luceferase. Doing a MRNA-CDNA-PCR on incoming specimens and then another after light production may answer this question and clear up any questions. Dr Lewis mentioned that in order the truly understand the entire genes responsible for luminescence I would need to look at the entire genome by using a microaray. i will need to find out more information it may be beneficial to locate the genome since I do not believe it has been done as of yet. 

The enclosure is complete setup and put together as well as the artemia enclosure. I placed 7 2 gallon buckets in the bottom with sifted find sand donated by the fisheries department. A timer with light has been setup but will need to be worked with to make sure it is on the correct light cycle. 

Greg will be acquiring up the animals this coming Saturday 8/9/2014 from Bainbridge island Crystal Springs pier were I will pick them up after the dive and transfer them to uw

Have not been able to complete history portion of the proposal since I have had to many questions on the process of the experiment and do not feel confident enough to finish it but now that I was able to talk to Dr. Lewis, and Al-noori i think I have a clearer idea on what to do. 

For the manipulation experiment I am going to put the animals in both and oxygen depletion, calcium manipulation and ocean acidification environment and then measure the illuminations with a camera to see if their is any change. This will also give me the ability to check the genetics to see if the production of luceferase is being manipulated. or if I am able to get the entire genome I may be able to look at more of the reaction and see what all genes are responsible for the process. I will talk to Dr. Roberts to look into it. 

I also saw some information that states that the sea pens may illuminate at night so I would like to find a way to recorded the live stream and be able to look over it to see if this is true not only will it be wonderful to see but could give me the ability to test their luminescence without having to stress the animal out by touching it but will not know till they arrive and are comfortable in the setup. 

i need to really comb through the reaction and pull as much information I am going to look into a permanent dry erase board that I can have access to to write out the entire reaction and be able to study and develop. It seems to help me understand better when I can step back and look and the entire thing. The quarter is coming to and end so I will need to continue the research next quarter which will give me the chance to do all of my experiments and know the pens are being taken care of. Building access was figured out so I can come in and take care of the pens even on weekends. 

Thursday, July 24, 2014

7/24

Had a meeting with Dr. Lewis from UW Bothell to help clarify some biology concepts about genetics and to help understand choosing primers and interpreting results of other researchers Genetic results. Choose primers so I can now order them for research.

Primer potentials

forward CGGCAAAAGCTAGCGTTGAA

reverse    ACGTGCGGTCTCTTTATGCT

Wednesday, July 23, 2014

7/21

Got in contact with Greg and he agreed to collect the specimens for me.

Artemia are looking like the best bet for feeding the pens, Talked with Greg today and he recommended it as well. Since the tank is connected to a larger system I do not want to throw off anything plus the artemia are easy to work with.